| read.dna {ape} | R Documentation |
This function reads DNA sequences in a file, and returns a matrix or a
list of DNA sequences with the names of the taxa read in the file as
rownames or names, respectively. By default, the sequences are stored
in binary format, otherwise (if as.character = "TRUE") in lower
case.
read.dna(file, format = "interleaved", skip = 0,
nlines = 0, comment.char = "#", seq.names = NULL,
as.character = FALSE, as.matrix = NULL)
file |
a file name specified by either a variable of mode character, or a double-quoted string. |
format |
a character string specifying the format of the DNA
sequences. Four choices are possible: |
skip |
the number of lines of the input file to skip before beginning to read data. |
nlines |
the number of lines to be read (by default the file is read untill its end). |
comment.char |
a single character, the remaining of the line after this character is ignored. |
seq.names |
the names to give to each sequence; by default the names read in the file are used. |
as.character |
a logical controlling whether to return the
sequences as an object of class |
as.matrix |
(used if |
This function follows the interleaved and sequential formats defined in PHYLIP (Felsenstein, 1993) but with the original feature than there is no restriction on the lengths of the taxa names. For these two formats, the first line of the file must contain the dimensions of the data (the numbers of taxa and the numbers of nucleotides); the sequences are considered as aligned and thus must be of the same lengths for all taxa. For the FASTA format, the conventions defined in the URL below (see References) are followed; the sequences are taken as non-aligned. For all formats, the nucleotides can be arranged in any way with blanks and line-breaks inside (with the restriction that the first ten nucleotides must be contiguous for the interleaved and sequential formats, see below). The names of the sequences are read in the file unless the ‘seq.names’ option is used. Particularities for each format are detailed below.
Interleaved:the function starts to read the sequences when it finds 10 contiguous characters belonging to the ambiguity code of the IUPAC (namely A, C, G, T, U, M, R, W, S, Y, K, V, H, D, B, and N, upper- or lowercase, so you might run into trouble if you have a taxa name with 10 contiguous letters among these!) All characters before the sequences are taken as the taxa names after removing the leading and trailing spaces (so spaces in a taxa name are allowed). It is assumed that the taxa names are not repeated in the subsequent blocks of nucleotides.
Sequential:the same criterion than for the interleaved format is used to start reading the sequences and the taxa names; the sequences are then read until the number of nucleotides specified in the first line of the file is reached. This is repeated for each taxa.
Clustal:this is the format output by the Clustal programs (.aln). It is somehow similar to the interleaved format: the differences being that the dimensions of the data are not indicated in the file, and the names of the sequences are repeated in each block.
FASTA:This looks like the sequential format but the taxa names (or rather a description of the sequence) are on separate lines beginning with a ‘greater than’ character “>” (there may be leading spaces before this character). These lines are taken as taxa names after removing the “>” and the possible leading and trailing spaces. All the data in the file before the first sequence is ignored.
a matrix or a list (if format = "fasta") of DNA sequences
stored in binary format, or of mode character (if as.character =
"TRUE").
Emmanuel Paradis
Anonymous. FASTA format description. http://www.ncbi.nlm.nih.gov/BLAST/fasta.html
Anonymous. IUPAC ambiguity codes. http://www.ncbi.nlm.nih.gov/SNP/iupac.html
Felsenstein, J. (1993) Phylip (Phylogeny Inference Package) version 3.5c. Department of Genetics, University of Washington. http://evolution.genetics.washington.edu/phylip/phylip.html
read.GenBank, write.dna,
DNAbin, dist.dna, woodmouse
### a small extract from `data(woddmouse)'
cat("3 40",
"No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
"No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
"No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
file = "exdna.txt", sep = "\n")
ex.dna <- read.dna("exdna.txt", format = "sequential")
str(ex.dna)
ex.dna
### the same data in interleaved format...
cat("3 40",
"No305 NTTCGAAAAA CACACCCACT",
"No304 ATTCGAAAAA CACACCCACT",
"No306 ATTCGAAAAA CACACCCACT",
" ACTAAAANTT ATCAGTCACT",
" ACTAAAAATT ATCAACCACT",
" ACTAAAAATT ATCAATCACT",
file = "exdna.txt", sep = "\n")
ex.dna2 <- read.dna("exdna.txt")
### ... in clustal format...
cat("CLUSTAL (ape) multiple sequence alignment", "",
"No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
"No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
"No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
" ************************** ****** ****",
file = "exdna.txt", sep = "\n")
ex.dna3 <- read.dna("exdna.txt", format = "clustal")
### ... and in FASTA format
cat("> No305",
"NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
"> No304",
"ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
"> No306",
"ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
file = "exdna.txt", sep = "\n")
ex.dna4 <- read.dna("exdna.txt", format = "fasta")
### The first three are the same!
identical(ex.dna, ex.dna2)
identical(ex.dna, ex.dna3)
identical(ex.dna, ex.dna4)
unlink("exdna.txt") # clean-up